Trace Archive RFC Version 2.4
Table of Contents
Preface
This is a revised version of the original Trace Archive RFC. The purpose of this document is to specify a means of exchange of traces and their ancillary data. In the four years that have elapsed since the Trace Archive was originally developed, the scope and uses of the data have evolved. Revisions have been made this document will clarify, and in some instances change, the contents that are to be submitted in specific fields. To accommodate new data sources, additional fields need to be added and specified. In addition, required data for specific trace types will be clarified. This proposal covers:
The biggest changes involve:
The addition of new fields to accommodate environmental sample data
- These additional fields allow the storage of experimental data related to the field. This is especially important as these sets of data do not fit into our normal taxonomic classification of traces.
Modification of the description of the STRATEGY and TRACE_TYPE_CODE fields
- Currently, STRATEGY and TRACE_TYPE_CODE fields are largely redundant. The proposal involves changing the description of the STRATEGY field to reflect the experimental strategy (rather than the sequencing strategy) used to produce a trace. This should not only better reflect the data, but also make retrieval of large sets of data easier.
Changing the SUBSPECIES_ID field to STRAIN field
- Most of the data in SUBSPECIES_ID field was actually related to STRAIN or cultivar information, so it makes some degree of sense to change the name of this field. Subspecies information can be related in the SPECIES_CODE field.
Addition of new requirements
- Currently, it is quite difficult to use certain data sets because there is not enough ancillary data associated with the trace. Initially, the trace archive had few restrictions because not every field is applicable to every TRACE_TYPE_CODE and STRATEGY combination. There is no change to the fields that are required for all submissions, but there now are fields that are required for specific combinations of STRATEGY and TRACE_TYPE_CODE. You may check requirements in the Validation Table
Accommodation of new sequencing technologies and data types
- As sequencing technology emerges, standard dideoxy sequencing is being supplemented with other sequencing technologies such as chip based resequencing technologies as well as synthesis based technologies like the 454 Life Sciences technology. We will also be accepting other data types, such as AFLP mapping data. In order to accept these data we are adding new fields, and in some cases additional files, in order to fully capture the raw information
Goals
The original goal of the Trace Archive was largely related to data storage. However, over the last three years, the scope of the Trace Archive has grown substantially. The current goals of the Trace Archive are:
Archival data storage of sequence traces:
- Database storage
Easy retrieval of individual traces and groups of traces:
- Retrieval based on specific ancillary information
- Retrieval based on sequence comparison
The NCBI and Ensembl are collaborating to store all of the traces. There is an ongoing effort to keep the two sites synchronized with respect to trace content.
Ancillary Information
For the Trace Archive to be a useful resource, the archive must contain information describing the traces. Different sequencing centers have different naming schemes that are not mutually exclusive and it is likely that the schemes can change over time. While the name of the trace conveys some information, it is not sufficient for fully describing the data. Sequencing centers generally use the trace name as a unique key within their databases. The Trace Archive will use a combination of the center name and trace name as a unique key. In addition, every trace will be assigned a unique trace identifier. The trace identifier will be an integer value and can also function as a unique key. When the actual trace for a particular record is updated, the current TI will be replaced by a new TI. A change in TI will not occur for an update of ancillary information only. The ancillary data information should be contained in a separate file. This file can be a tab delimited text file or it can use XML format. The format of the TRACEINFO file is described in the Submission Information.
The list of ancillary data fields are described below.
Field List
The ancillary information fields defined for the Trace Archive are listed below.
RED color designates fields that are required
GREEN color designates fields that may be required, depending upon the trace type and strategy employed.
A field may be mandatory, optional or not allowed for a given combination of strategy and trace type as indicated below.
Modifications/additions from the original RFC are in red if these changes affect either a field requirement, or the definition of a field. Slight changes to affect document clarity are not noted.
-
ACCESSION - Genbank/EMBL/DDBJ accession number
-
Name: ACCESSIONType: varchar(30)Example: AC22227
- The ACCESSION is assigned upon deposition to a public repository (GenBank/EMBL/DDBJ). This field will not be applicable to all trace types (primarily WGS). However, if this field contains a valid accession identifier correlation between the primary sequence data (in Trace) and the secondary sequence data (in the public repository) is facilitated.
-
AMPLIFICATION_FORWARD - The forward amplification primer sequence
-
Name: AMPLIFICATION_FORWARDType: varchar(100)Example: GGATTCTGACTAACGAGC
- The AMPLIFICATION_FORWARD field is to allow submitters to define the primers used to amplify templates for sequencing. This field is required when TRACE_TYPE_CODE=PCR or RT-PCR.
-
AMPLIFICATION_REVERSE - The reverse amplification primer sequence
-
Name: AMPLIFICATION_REVERSEType: varchar(100)Example: GGATTCTGACTAACGAGC
- The AMPLIFICATION_REVERSE field is to allow submitters to define the primers used to amplify templates for sequencing. This field is required when TRACE_TYPE_CODE=PCR or RT-PCR.
-
AMPLIFICATION_SIZE - The expected amplification size for a pair of
primers
-
Name: AMPLIFICATION_SIZEType: intExample: 500
- The AMPLIFICATION_SIZE field allows submitters to define the expected amplification size for a pair of primers (defined in the AMPLIFICATION_FORWARD and AMPLIFICATION_REVERSE fields). This number should be given in base pairs. If TRACE_TYPE_CODE=PCR, the amplification size is based on amplification of genomic DNA. If the TRACE_TYPE_CODE=RT-PCR, then the amplification size is based on amplification of transcript.
-
ANONYMIZED_ID - Anonymous ID for an individual.
-
Name: ANONYMIZED_IDType: varchar(100)Example: 2222anonym
- Used in projects to maintain the anonymity of donors. In many cases, there my be a controlled access database that can map many anonymized_ids in the trace archive to a single individual id for which phenotypic information may be available.
-
ATTEMPT - Number of times the
sequencing project has been attempted by the center and/or submitted to the
Trace Archive.
-
Name: ATTEMPTType: tinyint(1-255)Example: 2
-
BASE_FILE - File name with base calls
-
Name: BASE_FILEType: varchar(200)Example: ./mytraces/123clone.fasta
- Tracefiles which do not include the basecalls must provide this information in a separate file. The file designations are recorded in the BASE_FILE and QUAL_FILE fields of the TRACEINFO file. The actual bases are stored in the file designated in the BASE_FILE field. If base calls and quality scores are provided in separate files the information in these files will overwrite any information in the trace ( usually *.scf) file. If the base calls and quality scores that would be provided in the BASE_FILE and QUAL_FILE are the same as the information in the trace file DO NOT PROVIDE THE FILE. Providing redundant information complicates the loading process. However, it is important to note that if some formats do not include the quality scores, then these values must be provided as ancillary information. If the center provides the BASE_FILE and QUAL_FILE, then the peak index information should also be provided in a file called PEAK_FILE.
-
CENTER_NAME - Name of the sequencing center.
-
Name: CENTER_NAMEType: varchar(50)Example: WUGSC
- Sequencing centers wishing to submit data must contact the Trace Archive administrators () to determine a center abbreviation. This abbreviation is used in the CENTER_NAME field. This field has a controlled vocabulary. For the complete list of submitting centers see: www.ncbi.nlm.nih.gov/Traces/trace.cgi?cmd=stat&f=xml_list_centers&m=obtain&s=center
-
CENTER_PROJECT - Center defined project name
-
Name: CENTER_PROJECTType: varchar(100)Example: HBBB
- The CENTER_PROJECT reflects a sequencing center's internal designation for a specific sequencing project. This field can be useful for grouping related traces.
-
CHEMISTRY - Description of the chemistry used in the sequencing reaction
-
Name: CHEMISTRYType: varchar(50)Example: BIGDYEV3.0
-
CHEMISTRY_TYPE - Type of chemistry used in the sequencing reaction
-
Name: CHEMISTRY_TYPEType: char(50)Example: P
-
The CHEMISTRY_TYPE uses a controlled list. Accepted values are:
Primer Terminator p=primer t=terminator
-
CHROMOSOME - Chromosome to which the
trace is assigned
-
Name: CHROMOSOMEType: varchar(8)Example: 11
- The CHROMOSOME indicates to which chromosome a trace has been assigned. Gene names or cytogenetic positions are not appropriate substitutes for chromosome information.
-
CLIP_QUALITY_LEFT - Left clip of the read, in
base pairs, based on quality analysis
-
Name: CLIP_QUALITY_LEFTType: intExample: 56
- The CLIP_QUALITY_LEFT field indicates the base at the beginning of the sequence at which the read should be clipped due to poor quality sequence. The given value would be the first base of the high quality region of the trace.
-
CLIP_QUALITY_RIGHT - Right clip of the read,
in base pairs, based on quality analysis.
-
Name: CLIP_QUALITY_RIGHTType: intExample: 256
- The CLIP_QUALITY_RIGHT field indicates the base at the end of the sequence at which the read should be clipped due to poor quality sequence. The given value would be the last base of the high quality region of the trace.
-
CLIP_VECTOR_LEFT - Left clip of the read, in
base pairs, based on vector sequence.
-
Name: CLIP_VECTOR_LEFTType: intExample: 75
- The CLIP_VECTOR_LEFT field indicates the base at the beginning of the sequence at which the read should be clipped due to vector sequence. The given value would be the first base of non-vector sequence. This field is required for almost all combinations of STRATEGY and TRACE_TYPE_CODE. This information can be omitted if the INSERT_FLANK_LEFT field is populated or TRACE_TYPE_CODE is PCR or RT-PCR.
-
CLIP_VECTOR_RIGHT - Right clip of the read,
in base pairs, based on vector sequence.
-
Name: CLIP_VECTOR_RIGHTType: intExample: 275
-
The CLIP_VECTOR_RIGHT
field indicates the base at the end of the sequence at which the read
should be clipped due to vector sequence. The given value would be the last
non-vector sequence. This field is required for almost all combinations of
STRATEGY and TRACE_TYPE_CODE.
This information can be omitted if the
INSERT_FLANK_RIGHT field is populated or
TRACE_TYPE_CODE is PCR or RT-PCR.
NOTE: Many centers combine vector and quality analysis, and thus have only one set of clip values. In this case, the set of values should be placed in the CLIP_VECTOR_LEFT/CLIP_VECTOR_RIGHT fields.
NOTE: There have been some requests to make all of the clip value fields required. For various reasons, including the note above, this position has not been adopted. The decision was that either the CLIP_VECTOR_LEFT/CLIP_VECTOR_RIGHT fields should be required or the vector information (SVECTOR_ACCESSION field) should be supplied. However, since most centers use sequencing vectors that are not in GenBank/EMBL/DDBJ it seems more likely that the trim values will be given or INSERT_FLANK_RIGHT and INSERT_FLANK_LEFT fields are populated.
-
CLONE_ID - The name of the clone
from which the trace was derived
-
Name: CLONE_IDType: varchar(30)Example: RP23-1123F10
-
The CLONE_ID
field is used to store the identifier related to an individual clone, for
example a BAC clone, PAC clone or cDNA clone. If the clone is registered with
the clone registry (www.ncbi.nlm.nih.gov/genome/clone/), standard
clone registry nomenclature (see https://www.ncbi.nlm.nih.gov/genome/clone/
nomenclature.shtml for more details) should be used. It is now proposed
that this field would be required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=cDNA; TRACE_TYPE_CODE=Any
STRATEGY=EST; TRACE_TYPE_CODE=Any
STRATEGY=CLONEEND; TRACE_TYPE_CODE=CLONEEND
STRATEGY=CLONE; TRACE_TYPE_CODE=Any
STRATEGY=ENCODE; TRACE_TYPE_CODE=SHOTGUN; PrimerWalk; CLONEEND
STRATEGY=FINISHING; TRACE_TYPE_CODE=Any
-
CLONE_ID_LIST - Semi-colon delimited
list of clones if the Strategy is PoolClone.
-
Name: CLONE_ID_LISTType: varchar(30)Example: RP23-200A2;RP23-500P1
-
The CLONE_ID_LIST field is used only if
STRATEGY =PoolClone. In this case, the list of clones is provided as a semicolon
delimited list. If the clones are registered with the Clone Registry,
standard clone registry nomenclature should be used (see
CLONE_ID field).
Note: The list of clones is not limited, but the size of the individual clone within the list is limited to 30 bytes.
It is now proposed that this field would be required for the following combination of STRATEGY and TRACE_TYPE_CODE:
STRATEGY=PoolClone; TRACE_TYPE_CODE=Any
-
COLLECTION_DATE - The full date, in "Mar 2 2006 12:00AM" format,
on which an environmental sample was collected.
-
Name: COLLECTION_DATEType: datetimeExample: Mar 2 2006 12:00AM
-
The COLLECTION_DATE
field is used to define the date and time on which an environmental sample was
collected. This field would be required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=Env Sample- Geo; TRACE_TYPE_CODE=Any
STRATEGY=Env Sample- Host; TRACE_TYPE_CODE=Any
-
CVECTOR_ACCESSION - Repository (
GenBank/EMBL/DDBJ) accession identifier for the cloning vector.
-
Name: CVECTOR_ACCESSIONType: varchar(50)Example: AY451994
- The CVECTOR_ACCESSION field holds the accession number for the cloning vector used. This cloning vector relates to the clone named in the CLONE_ID field.
-
CVECTOR_CODE - Center defined code
for the cloning vector
-
Name: CVECTOR_CODEType: varchar(50)Example: PBACE3.6
- The CVECTOR_CODE field holds the user defined identifier for the cloning vector. Submitters are encouraged to submit all vector sequence information to public repositories. However, it is understood that many sequencing centers sequence clones from libraries they did not prepare.
-
DEPTH - Depth (in meters) at which an
environmental sample was collected.
-
Name: DEPTHType: floatExample: 10M
- The DEPTH field is applicable to water samples and earth samples. If the value of this field is NULL, it is anticipated the sample was taken from the surface of the environment. While this field is only applicable to environmental samples, it is not required.
-
ELEVATION - Elevation (in meters) at which
an environmental sample was collected
-
Name: ELEVATIONType: floatExample: 500
- If the value of this field is NULL it is assumed the data were obtained at sea level. The field ELEVATION is only applicable to some environmental sample data, but is not a required field.
-
ENVIRONMENT_TYPE - Type of
environment from which an environmental sample was collected.
-
Name: ENVIRONMENT_TYPEType: varchar(250)Example: sea water
-
The ENVIRONMENT_TYPE
field is used to describe the specific environment from which an
environmental sample was taken. While the LATITUDE
and LONGITUDE
fields describe the location many types of environmental types could exist
at this location (for example, soil, sludge, tree roots, etc). This field
would be required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=Env Sample - Geo; TRACE_TYPE_CODE=Any
-
EXTENDED_DATA - Extra ancillary information wrapped
around in a EXTENDED_DATA block, where actual values are provided
with a special <field> tag
-
Name: EXTENDED_DATAType: varchar()Example:
<extended_data> <field name='SamplingSiteMonthChlorophyllLevel'>1.4 mg_mm</field> <field name='SamplingSiteYearlyChlorophyllLevel'>1.12 mg_mm</field> <field name='SamplingSiteYearlyChlorophyllLevelStdError'>0.19 mg_mm</field> </extended_data> - The '=' sign and the field separator character '|'should be excluded from names and their values. No other validity checks will be performed on the data. Although the number of <field> tags is not limited we are going to limit the total size of the block to 2 KB.
-
FEATURE_ID_FILE - File describing
the features and their locations on a chip.
-
Name: FEATURE_ID_FILEType: varchar(200)Example: ./mytraces/chip2.cdf
- The FEATURE_ID_FILE provides the location and sequence of the features for a given chip when TRACE_TYPE_CODE="CHIP".
-
FEATURE_ID_FILE_NAME - Reference to a common
FEATURE_ID_FILE which
should be submitted first.
-
Name: FEATURE_ID_FILE_NAMEType: varchar(200)Example:
- This field is required when TRACE_TYPE_CODE="CHIP".
-
FEATURE_SIGNAL_FILE - File giving
the signal and variance for features on a chip.
-
Name: FEATURE_SIGNAL_FILEType: varchar(200)Example: ./mytraces/chip2.signal
- The FEATURE_SIGNAL_FILE provides the signal and variance of signal for the features on a given chip when TRACE_TYPE_CODE="CHIP".
-
FEATURE_SIGNAL_FILE_NAME - Reference to a common
FEATURE_SIGNAL_FILE which
should be submitted first.
-
Name: FEATURE_SIGNAL_FILE_NAMEType: varchar(200)Example:
- This field is required when TRACE_TYPE_CODE="CHIP".
-
GENE_NAME - Gene name or some other common identifier
-
Name: GENE_NAMEType: varchar(100)Example: transporter 1
- Free text. Mainly this field would be for TRACE_TYPE_CODE='Re-sequencing' or 'ENCODE'. When a group is analyzing a particular gene, they may want to refer to that gene by it's name or some other common identifier. Gene names not in Entrez Gene can be used (for instance, Ensembl genes).
-
HI_FILTER_SIZE - The largest filter
used to stratify an environmental sample.
-
Name: HI_FILTER_SIZEType: varchar(50)Example: 50 micron
- The HI_FILTER_SIZE field is applicable only to environmental sample data but is not a required field.
-
HOST_CONDITION - The condition of
the host from which an environmental sample was obtained.
-
Name: HOST_CONDITIONType: varchar(100)Example: HIV-positive
- The HOST_CONDITION field is only applicable to environmental sample data and is used to describe the condition (healthy, sick, etc) of the host from which a sample was taken.
-
HOST_ID - Unique identifier for the
specific host from which an environmental sample was taken.
-
Name: HOST_IDType: varchar(100)Example: yerkes pedigree #C0479 'Clint'
-
The HOST_IDENTIFIER
field is only applicable to environmental sample data and is used to
capture the unique name for the specific host from which a sample was obtained.
This field would be required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=Env Sample- Host; TRACE_TYPE_CODE=Any
-
HOST_LOCATION - Specific location
on the host from which an environmental sample was collected.
-
Name: HOST_LOCATIONType: varchar(100)Example: rumen
-
The HOST_LOCATION
field is only applicable to environmental sample data and is used to
describe the specific part of the host from which the sample was obtained, for
example: dental plaque, hindgut, root surfaces. This field would be
required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=Env Sample- Host; TRACE_TYPE_CODE=Any
-
HOST_SPECIES - The host from which an environmental sample was obtained.
-
Name: HOST_SPECIESType: varchar(100)Example: Pan troglodytes
-
The HOST_SPECIES
field is only applicable to environmental sample data. This field would
be required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=Env Sample- Host; TRACE_TYPE_CODE=Any
-
INDIVIDUAL_ID - Publicly available identifier to denote a specific
individual or sample from which a trace was derived.
-
Name: INDIVIDUAL_IDType: varchar(100)Example: NA12345
- The INDIVIDUAL_ID field provides a center specific unique id that can associate a specific trace to an individual. This will be used primarily for population based studies.
-
INSERT_FLANK_LEFT - Flanking sequence at the cloning junction.
-
Name: INSERT_FLANK_LEFTType: varchar(100)Example: AAGGTGCGATGCAGTGGCAGTAGCAGTGTCGACGTGACGATTCGTCCGGA
- The INSERT_FLANK_LEFT field should provide from 50 up to 100 bases of sequence (including linkers) to the left of the cloning junction. This information will allow users to perform their own vector trimming of reads. This field is required for almost all combinations of STRATEGY and TRACE_TYPE_CODE. This field can be omitted if CLIP_VECTOR_LEFT is populated. However, INSERT_FLANK_LEFT is the preferred choice. If there was no cloning step involved in the sequencing, please populate the field with 'NONE'.
-
INSERT_FLANK_RIGHT - Flanking sequence at the cloning junction.
-
Name: INSERT_FLANK_RIGHTType: varchar(100)Example: AAGGCGCGATGCAGTGAGCGAGGCTGACGTCGGCTAGCGTCGCGTCGGGT
- The INSERT_FLANK_RIGHT field should provide from 50 up to 100 bases of sequence (including linkers) to the right of the cloning junction. This information will allow users to perform their own vector trimming of reads. This field is required for almost all combinations of STRATEGY and TRACE_TYPE_CODE. This field can be omitted if CLIP_VECTOR_RIGHT is populated. However, INSERT_FLANK_RIGHT is the preferred choice. If there was no cloning step involved in the sequencing, please populate the field with 'NONE'. It is anticipated that if INSERT_FLANK_LEFT is populated that INSERT_FLANK_RIGHT will also be populated. It is not anticipated that a mixture of clip values and junction sequence will be specified. (i.e. CLIP_VECTOR_LEFT and INSERT_FLANK_RIGHT populated for the same record.
-
INSERT_SIZE - Expected size of the insert (referred to by the value in the TEMPLATE_ID field) in base pairs.
-
Name: INSERT_SIZEType: intExample: 2000
-
The INSERT_SIZE
field indicates the expected insert size of the clone that is sequenced. It
is understood that this is an estimate based upon the average insert sizes found
in a given library. However, this information is critical for certain
experiments, such as whole genome assembly. This field would be required
for the following combination of STRATEGY and
TRACE_TYPE_CODE:
STRATEGY=Any; TRACE_TYPE_CODE=WGS
STRATEGY=Any; TRACE_TYPE_CODE=WCS
STRATEGY=cDNA; TRACE_TYPE_CODE=CLONEEND
STRATEGY=CLONEEND; TRACE_TYPE_CODE=CLONEEND
-
INSERT_STDEV - Approximate standard deviation of value in INSERT_SIZE field
-
Name: INSERT_STDEVType: intExample: 200
-
The INSERT_STDEV
field reflects the approximate standard deviation of the insert size. It is
understood that this information is an approximation and may change as better
data is obtained. This field would be required for the following
combination of STRATEGY and TRACE_TYPE_CODE:
STRATEGY=Any; TRACE_TYPE_CODE=WGS
STRATEGY=Any; TRACE_TYPE_CODE=WCS
STRATEGY=cDNA; TRACE_TYPE_CODE=CLONEEND
STRATEGY=CLONEEND; TRACE_TYPE_CODE=CLONEEND
-
LATITUDE - The latitude measurement (using
standard GPS notation) from which a sample was collected.
-
Name: LATITUDEType: floatExample: 54.736
- The LATITUDE field is required to describe the collection of some environmental sample data. The latitude range is [-90,90] with the equator as 0 latitude and positive values of latitude are north of the equator. This field would be required for the following combination of STRATEGY and TRACE_TYPE_CODE: STRATEGY=Env Sample- Geo; TRACE_TYPE_CODE=Any
-
LIBRARY_ID - The source of the clone identified in the CLONE_ID field
-
Name: LIBRARY_IDType: varchar(100)Example: RP23
-
The LIBRARY_ID
field documents the source library of the archival clone resource. Many
genomic libraries have been registered with the Clone Registry (
https://www.ncbi.nlm.nih.gov/genome/clone/
) and the standard nomenclature (
https://www.ncbi.nlm.nih.gov/genome/clone/clbrowse.cgi
) should be used for these libraries. This field would be required for the following combination of
STRATEGY and TRACE_TYPE_CODE:
STRATEGY=cDNA; TRACE_TYPE_CODE=Any
STRATEGY=EST; TRACE_TYPE_CODE=Any
STRATEGY=CLONEEND; TRACE_TYPE_CODE=CLONEEND
STRATEGY=CLONE; TRACE_TYPE_CODE=Any
STRATEGY=ENCODE; TRACE_TYPE_CODE=SHOTGUN; PrimerWalk; CLONEEND
-
LONGITUDE - The longitude measurement (using standard GPS notation) from which a sample
was collected.
-
Name: LONGITUDEType: floatExample: -86.403
-
The LONGITUDE field is required to describe the collection of some environmental sample
data. The longitude is ranging from 0° at the Prime Meridian to +180° eastward and −180° westward.
This field would be required for the following
combination of STRATEGY and
TRACE_TYPE_CODE:
STRATEGY=Env Sample- Geo; TRACE_TYPE_CODE=Any
-
LO_FILTER_SIZE - The smallest filter size used to stratify an environmental sample.
-
Name: LO_FILTER_SIZEType: varchar(50)Example: 25 micron
- The LO_FILTER_SIZE field is only applicable to environmental sample data but is not a required field.
-
NCBI_PROJECT_ID - Project ID generated by the
Genome Project database at NCBI/NLM/NIH
-
Name: NCBI_PROJECT_IDType: intExample: 7
- NCBI_PROJECT_ID field would allow to link traces to Genome Project database and easily retrieve sets of traces from each Project. Genome sequencing centers may register their project prior the submission of genomic sequence data. Submitters need not submit sequencing data at the time they register their project.
-
ORGANISM_NAME - Description of species for BARCODE project
from which trace is derived.
-
Name: ORGANISM_NAMEType: varchar(100)Example: Acanthocybium solandri
- The ORGANISM_NAME field is used to classify the read by species for BARCODE data, using proper taxonomic name in accordance with Taxonomy Browser. SPECIES_CODE="BARCODE SPECIES" for all traces from this project. This field would be required for the STRATEGY=BARCODE.
-
PEAK_FILE - Name of file that contains the list of peak values.
-
Name: PEAK_FILEType: varchar(200)Example: ./mytraces/123clone.peak
- Consult the BASE_FILE field description for more information.
-
PH - The pH at which an environmental sample was collected.
-
Name: PHType: floatExample: 7.2
- The PH field is only applicable to environmental sample data but is not a required field.
-
PICK_GROUP_ID - Id to group traces picked at the same time.
-
Name: PICK_GROUP_IDType: intExample: 939065
-
PLACE_NAME -
Country in which the biological sample was collected and/or common name for a given location.
-
Name: PLACE_NAMEType: varchar(250)Example: Octopus Springs
- The PLACE_NAME field is applicable to environmental sample data, but is not required.
-
PLATE_ID - Submitter defined plate id
-
Name: PLATE_IDType: varchar(32)Example: 203
- The PLATE_ID and WELL_ID fields are intended to identify the storage location of the sequencing template (not the library well coordinate of an archival clone named in the CLONE_ID field). This may enable flipped or contaminated trays to be easily identified. If a particular experiment did not require the use of a plate, please populate this field with '0'.
-
POPULATION_ID - Center provided id
to designate a population from which a trace (or group of traces) was derived.
-
Name: POPULATION_IDType: varchar(100)Example: CEPH
- The POPULATION_ID field is used to capture center specific designations of groups of individuals. This will likely only be useful in population studies (usually STRATEGY=SNP).
-
PREP_GROUP_ID - ID that defines
groups of traces prepared at the same time.
-
Name: PREP_GROUP_IDType: varchar(30)Example: A2
-
PRIMER - The primer sequence (used
in the sequencing reaction)
-
Name: PRIMERType: varchar(200)Example: GAATACCTACGATCGCC
- The value of the PRIMER field is the actual base sequence of the sequencing primer used. If a center uses a primer extensively, the primer sequence can be entered into the list of primer codes and the PRIMER_CODE field can be used.
-
PRIMER_CODE - Identifier for the sequencing primer used.
-
Name: PRIMER_CODEType: varchar(30)Example: Sp6
-
PRIMER_LIST - A ';' delimited list
of primers used in a mapping experiment (such as AFLP)
-
Name: PRIMER_LISTType: varchar(100)Example: AAGGTCTGCGCGTGTC;AGCTGCGTACGTAATCG;
- This field is required if Strategy ="AFLP" and TRACE_TYPE_CODE ="PCR".
-
PROGRAM_ID - The program used to create the trace file.
-
Name: PROGRAM_IDType: varchar(100)Example: phred-19990722h
-
The PROGRAM_ID
field is used to indicate the base calling program. This field is free text.
Program name, version numbers or dates are very useful. More example values:
- phred-19980904e
- abi-3.1
- ATQA
- TraceTuner
- Licor
- Megabase
- Beckman
-
PROJECT_NAME - Term by which to group traces from different centers
based on a common project.
-
Name: PROJECT_NAMEType: varchar(50)Example: New Project
- In this way sequencing centers that are working on the same large project can group all of the traces for this project using a common term. This field has a controlled vocabulary. Sequencing centers wishing to submit data must contact the Trace Archive administrators () to determine a name that all members of the project agree on.
-
QUAL_FILE - Name of file containing the quality scores.
-
Name: QUAL_FILEType: varchar(200)Example: ./mytraces/123clone.fasta.qs
- See note associated with the BASE_FILE field.
-
REFERENCE_ACCESSION - Reference
accession (use accession and version to specify a particular instance of a
sequence) used as the basis for a re-sequencing project. In case of Comparative strategy show the basis for primers design.
-
Name: REFERENCE_ACCESSIONType: varchar(50)Example: NT_029829.1
- This field is required for the following combination of STRATEGY and TRACE_TYPE_CODE: STRATEGY=Re-sequencing; Comparative TRACE_TYPE_CODE=Any
-
REFERENCE_ACC_MAX - Finish position for a particular amplicon in
re-sequencing or comparative projects.
-
Name: REFERENCE_ACC_MAXType: intExample: 30929
- This field points to the finishing coordinate of the accession.version described in the REFERENCE_ACCESSION field. All coordinates should be in 1 base coordinates (i.e. sequences start at base 1, not base 0). This field is required for the following combination of STRATEGY and TRACE_TYPE_CODE: STRATEGY=Re-sequencing; TRACE_TYPE_CODE=SHOTGUN; PCR; RT-PCR
-
REFERENCE_ACC_MIN - Start position for a particular amplicon in
re-sequencing or comparative projects.
-
Name: REFERENCE_ACC_MINType: intExample: 29829
- This field points to the starting coordinate of the accession.version described in the REFERENCE_ACCESSION field. All coordinates should be in 1 base coordinates (i.e. sequences start at base 1, not base 0). This field is required for the following combination of STRATEGY and TRACE_TYPE_CODE: STRATEGY=Re-sequencing; TRACE_TYPE_CODE=SHOTGUN; PCR; RT-PCR
-
REFERENCE_OFFSET - Sequence offset of accession specified in
REFERENCE_ACCESSION field to define the coordinate start position used
as the basis for a re-sequencing project.
-
Name: REFERENCE_OFFSETType: intExample: 1520899
- This field points to the starting coordinate of the accession.version described in the REFERENCE_ACCESSION field. All coordinates should be in 1 base coordinates (i.e. sequences start at base 1, not base 0). This field is required for the following combination of STRATEGY and TRACE_TYPE_CODE: STRATEGY=Re-sequencing; TRACE_TYPE_CODE=CHIP
-
REFERENCE_SET_MAX - Finish position for a entire
re-sequencing region. This region may include several amplicons.
-
Name: REFERENCE_SET_MAXType: intExample: 29829
- This field points to the starting coordinate of the accession.version described in the REFERENCE_ACCESSION field for a entire re-sequencing region. All coordinates should be in 1 base coordinates (i.e. sequences start at base 1, not base 0). This field is required for The Cancer Genome Atlas (TCGA) project. The REFERENCE_ACC_[MIN|MAX] and REFERENCE_SET_[MIN|MAX] should refer to the same REFERENCE_ACC.
-
REFERENCE_SET_MIN - Start position for a entire
re-sequencing region. This region may include several amplicons.
-
Name: REFERENCE_SET_MINType: intExample: 29829
- This field points to the starting coordinate of the accession.version described in the REFERENCE_ACCESSION field for a entire re-sequencing region. All coordinates should be in 1 base coordinates (i.e. sequences start at base 1, not base 0). This field is required for The Cancer Genome Atlas (TCGA) project. The REFERENCE_ACC_[MIN|MAX] and REFERENCE_SET_[MIN|MAX] should refer to the same REFERENCE_ACC.
-
RUN_GROUP_ID - ID used to group traces run on the same machine.
-
Name: RUN_GROUP_IDType: varchar(30)Example: group2
-
RUN_LANE - Lane or capillary of the trace
-
Name: RUN_LANEType: intExample: 1
- The RUN_LANE documents the specific lane or capillary on which a trace was obtained.
-
RUN_MACHINE_ID - ID of the specific sequencing machine on which a trace was obtained
-
Name: RUN_MACHINE_IDType: varchar(30)Example: machine2
-
RUN_MACHINE_TYPE - Type or model of machine on which a trace was obtained.
-
Name: RUN_MACHINE_TYPEType: varchar(30)Example: ABI 310
-
SALINITY - The salinity at which an environmental sample was collected
measured in parts per thousand units (promille).
-
Name: SALINITYType: floatExample: 20
- The SALINITY field is only applicable to environmental sample data but is not a required field.
-
SEQ_LIB_ID - Center specified M13/PUC library that is actually sequenced.
-
Name: SEQ_LIB_IDType: varchar(255)Example: 22194
-
The SEQ_LIB_ID
field is the center identifier for the M13/PUC based clone that is actually
sequenced. This will allow grouping of traces by the actual ligation event
and is applicable to most projects. This value will be unique within a given
center. This field would be required for the following combination of STRATEGY
and TRACE_TYPE_CODE:
STRATEGY=Any; TRACE_TYPE_CODE=SHOTGUN
STRATEGY=Any; TRACE_TYPE_CODE=WGS/WCS
-
SOURCE_TYPE - Source of the DNA
-
Name: SOURCE_TYPEType: varchar(50)Example: GENOMIC DNA
-
The SOURCE_TYPE
field consists of a code. Possible values are:
- G = Genomic DNA (includes PCR products from genomic DNA)
- N = Non Genomic DNA (EST, cDNA, RT-PCR, screened libraries)
- VIRAL RNA = Viral RNA
- SYNTHETIC = Synthetic DNA
Accepted values are G, N, GENOMIC, NON GENOMIC, VIRAL RNA, SYNTHETIC
-
SPECIES_CODE - Description of species from which trace is derived
-
Name: SPECIES_CODEType: varchar(100)Example: Homo sapiens
- The SPECIES_CODE field is used to classify the read by species, using proper taxonomic names where possible. This field currently is maintained as a controlled vocabulary. For a list of species currently contained within the Trace Archive, see: www.ncbi.nlm.nih.gov/Traces/trace.cgi?cmd=stat&f=xml_list_species&m=obtain&s=species To submit a new species, please contact us () prior to submission. For cases in which it is unclear of the taxonomic origin of a specific trace the taxonomic classification 'ENVIRONMENTAL SEQUENCE' can be used in a case of environmental samples or 'ARTIFICIAL SEQUENCE' in a case of artificial material. A second proposal for this field involves incorporating subspecies information into the species code identifier and making the field SUBSPECIES_ID obsolete.
-
STRAIN - Strain from which a trace is derived.
-
Name: STRAINType: varchar(50)Example: C57BL/6J
- Strain is required for Strategy = "SNP"
-
STRATEGY - Experimental STRATEGY
-
Name: STRATEGYType: varchar(50)Example: MODEL VERIFY
-
In the original RFC, the STRATEGY field was proposed to contain the sequencing STRATEGY used in obtaining the trace. This definition made this field largely redundant with the TRACE_TYPE_CODE field. The proposal in this new version of the RFC is to make this field reflective of the experimental STRATEGY used when obtaining the trace. In some cases, this may still be redundant with the TRACE_TYPE_CODE field. Some records in the Trace Archive already contain some values in this field that are reflective of this idea. For example, the STRATEGY 'MODEL VERIFY' was proposed for a group of traces that were obtained in the process of verifying proposed gene models. In addition to conveying some information as to the original purpose of the trace, it will likely be useful in retrieving groups of traces in batch sets. It is proposed that this would be a controlled vocabulary, but that submitters would contribute to this list as needed to define various experiments and projects.
Original values:- CCS: Concatenated cDNA sequencing
- CLONE: Clone based sequencing
- ENCODE: Reads generated for the Encode project
- MODEL VERIFY: traces obtained to verify proposed gene models
- POOLCLONE: Pools of clones (BACs mostly)
- TRANSPOSON: Transposon based sequencing
- WCS: Whole Chromosome shotgun sequencing
- WGS: Whole Genome shotgun sequencing
Current values (this list would continually be expanding):- AFLP: Amplified Fragment Length Polymorphism
- BARCODE: DNA sequence analysis of a uniform target gene to enable species identification
- CCS: Concatenated cDNA sequencing
- cDNA: Sequences generated in the process of sequencing cDNA clones
- CF-S: Cot-filtered single/low-copy genomic DNA
- CF-M: Cot-filtered moderately repetitive genomic DNA
- CF-H: Cot-filtered highly repetitive genomic DNA
- CF-T: Cot-filtered theoretical single-copy DNA
- CLONE: Genomic clone based (hierarchical) sequencing
- CLONEEND: Sequences generated from the end of a clone (BAC/PAC/Fosmid or cDNA)
- Comparative: Sequences obtained using primers design from related species
- CTS: Concatenated Tag Sequencing
- Env Sample-GEO: Geographically generated environmental sample
- Env Sample-Host: Environmental samples collected from a specific host
- EST: single pass sequencing of cDNA templates
- FINISHING: a read specifically made for finishing, could be either BAC finishing or Whole Genome Assembly (WGA) finishing
- MODEL VERIFY: Sequences obtained to verify proposed gene models
- PoolClone: Pools of clones (BACs mostly)
- SNP: Reads used for SNP identification
- TARGETED LOCUS: Sequences obtained from templates generated by primers designed to amplify a specific genetic locus
- Re-sequencing: Re-sequencing of targeted genomic regions
- RT-PCR: Sequences obtained using templates generated by Reverse Transcriptase Polymerase Chain Reaction
- WGA: Whole Genome Assembly
-
SUBMISSION_TYPE - Type of submission
-
Name: SUBMISSION_TYPEType: varchar(50)Example: NEW
-
The SUBMISSION_TYPE field allowed values:
- NEW – use to submit new data
- UPDATE – use to renew traces and their ancillary information. Previous data will be saved with their TI's; new traces with the same trace_name's will receive new TI's and they will become active
- UPDATEINFO – use to update or add ancillary information for already existing traces without re-submitting the entire package of data
- WITHDRAW – use to withdraw traces
-
SVECTOR_ACCESSION - GenBank/EMBL/DDBJ accession of the sequencing vector.
-
Name: SVECTOR_ACCESSIONType: varchar(50)Example: X52325
-
SVECTOR_CODE - Center defined code for the sequencing vector
-
Name: SVECTOR_CODEType: varchar(50)Example: pBluescript SK(+)
-
TEMPERATURE - The temperature (in oC) at which an environmental sample was collected.
-
Name: TEMPERATUREType: floatExample: 30
- The TEMPERATURE field is only applicable to environmental sample data but it is not a required field.
-
TEMPLATE_ID - Submitter defined identifier for the sequencing template.
-
Name: TEMPLATE_IDType: varchar(50)Example: HBBBA2211
- The TEMPLATE_ID field is used to uniquely identify the actual template that is sequenced. This field, in conjunction with the TRACE_END field, can be used to identify traces that should be marked as 'mate_pairs' because they come from opposite ends of the same clone.
-
TRACE_END - Defines the end of the
template contained in the read.
-
Name: TRACE_ENDType: varchar(50)Example: F
-
The TRACE_END field can have the following values:
- F: FORWARD
- R: REVERSE
- N: UNKNOWN
-
TRACE_FILE - Filename with the
trace, relative to the top of the volume.
-
Name: TRACE_FILEType: varchar(200)?Example: ./traces/TRACE001.scf
-
TRACE_FORMAT - Format of the trace file.
-
Name: TRACE_FORMATType: varchar(20)Example: scf
- The TRACE_FORMAT field can have the following values:
-
TRACE_NAME - Center defined trace identifier.
-
Name: TRACE_NAMEType: varchar(250)Example: HBBBA1U2211
- The TRACE_NAME field must be unique within a center, but is not required to be unique between centers. The combination of TRACE_NAME and CENTER_NAME act as a unique key within the Trace Archive.
-
TRACE_TYPE_CODE - Sequencing strategy by which
the trace was obtained.
-
Name: TRACE_TYPE_CODEType: varchar(50)Example: wgs
-
The field TRACE_TYPE_CODE reflects the sequencing STRATEGY used to obtain the trace.
Original values:- CLONEEND: BAC/PAC/fosmid end sequence
- EST: Expressed sequence tag sequencing- single pass sequencing of a cDNA template
- FINISHING: a read generated for finishing a BAC project
- GSS: Genome Survey Sequences
- PCR: Sequences obtained using templates generated by Polymerase Chain Reaction
- RT-PCR: Sequences obtained using templates generated by Reverse Transcriptase Polymerase Chain Reaction
- SHOTGUN: generally refers to BAC based shotgun sequencing
- WCS: Whole Chromosome Shotgun
- WGS: Whole Genome Shotgun
Current values:- CHIP: Sequences obtained using microarrays (also called DNA chips or gene chips)
- CLONEEND: Sequences generated from the end of a large insert (BAC/PAC/Fosmid) or cDNA clone
- EST: Single Pass Expressed Sequence Tag
- HTP SELEX: High throughput SELEX
- OTHER: Other than PCR, PrimerWalk, SHOTGUN or TRANSPOSON for FINISHING STRATEGY
- PCR: Sequences obtained using templates generated by genomic Polymerase Chain Reaction
- PrimerWalk: Sequences generated through a primer walking step
- RT-PCR: Sequences obtained using templates generated by Reverse Transcriptase Polymerase Chain Reaction
- SHOTGUN: Shotgun sequencing of clones (genomic or cDNA)
- TRANSPOSON: Sequences obtained using templates generated by transposons
- WCS: Whole Chromosome Shotgun
- WGS: Whole Genome Shotgun
Obsolete values:- 454: Sequences obtained using the 454 technology
-
TRANSPOSON_ACC - GenBank/EMBL/DDBJ
accession for transposon used in generating sequencing template.
-
Name: TRANSPOSON_ACCType: varchar(50)Example: X00913
-
The TRANSPOSON_ACC would be required for the following combination of
STRATEGY and TRACE_TYPE_CODE:
STRATEGY =Any; TRACE_TYPE_CODE =TRANSPOSON
-
TRANSPOSON_CODE - Center defined
code for transposon used in generating sequencing template.
-
Name: TRANSPOSON_CODEType: varchar(50)Example: Mu transposon
-
This TRANSPOSON_CODE field would be required for the following combination of
STRATEGY and TRACE_TYPE_CODE:
STRATEGY =Any; TRACE_TYPE_CODE =TRANSPOSON
-
WELL_ID - Center defined well
identifier for the sequencing reaction.
-
Name: WELL_IDType: varchar(50)Example: A1
-
The field WELL_ID
in combination with the field PLATE_ID, is used to define the storage
location of the sequencing reaction (see note with the field WELL_ID).
Typically, sequencing reactions are performed in standard microtiter dishes
having either 96 or 384 wells. (see standard configurations below).

Standard 96 well microtiter configuration
Standard 384 well microtiter configuration
Internal Fields
Fields automatically assigned for each record as it is uploaded. Part of these fields is available to the user either following the submitter provided ancillary information on the webpage, or in the <ncbi_trace_archive> block in the xml_info retrieval section.
-
BASES_20 - Number of base pairs for which quality score exceed 20.
-
Name: BASES_20Type: smallintExample: 50
-
These fields can be used in a query to limit retrieve for the quality traces only.
Example of query:
center_name = 'ABC' and BASES_20 > 100
Warning: There are some depositions that don’t have quality scores. This is likely due to the center submitting ABI files and not providing quality calls separately.
-
BASES_40 - Number of base pairs for which quality score exceed 40.
-
Name: BASES_40Type: smallintExample: 50
-
These fields can be used in a query to limit retrieve for the quality traces only.
Example of query:
center_name = 'BCM' and BASES_40 > 70
Warning: There are some depositions that don’t have quality scores. This is likely due to the center submitting ABI files and not providing quality calls separately.
-
BASES_60 - Number of base pairs for which quality score exceed 60.
-
Name: BASES_60Type: smallintExample: 50
-
These fields can be used in a query to limit retrieve for the quality traces only.
Example of query:
center_name = 'WIBR' and BASES_60 > 50
Warning: There are some depositions that don’t have quality scores. This is likely due to the center submitting ABI files and not providing quality calls separately.
-
LOAD_DATE - Date on which the data was loaded.
-
Name: LOAD_DATEType: smalldatetimeExample: Jan 8 2001 11:59AM
-
This field helps to specify retrieve data by date.
Example of query:
species_code='MUS MUSCULUS' and load_date >= '12/11/2005'
-
MATE_PAIR - TI's of the reads obtained from the other end of the same template.
-
Name: MATE_PAIRType: intExample: 203682255
- MATE PAIR is the pair of reads obtained from two ends of the same template (FORWARD and REVERSE).
-
REPLACED_BY - TI that replaced the
current TI as "active"
-
Name: REPLACED_BYType: intExample: 304753779
- This field points to the more recent data set. If trace was updated then the REPLACED_BY field stores the TI for the new trace. If only ancillary information has been updated, then replaced_by=0 and is not shown.
-
STATE - indicates the status of the trace
-
Name: STATEType: varcharExample: active
-
Possible values:- active
- updated
- withdrawn
-
TAXID - NCBI Taxonomy ID.
-
Name: TAXIDType: intExample: 10090
- This field links Trace Archive with NCBI Taxonomy Browser.
-
TI - Trace unique internal Identifier.
-
Name: TIType: intExample: 304753779
- It is given for a record at the loading stage, and any record, or number of records can be obtain by their identifiers. These numbers can be used to query the database, either in a list "1,2,3,7,100003", through specifying a range "1-10" or in a combination of both "1,2, 5-10".
Obsolete fields
-
ASSEMBLY_ID - Public identifier for a given version of a genome assembly
-
Name: ASSEMBLY_IDType: varchar(50)Example: NCBI Build 33
- Please use REFERENCE_ACCESSION and REFERENCE_OFFSET
-
CHROMOSOME_REGION -
-
Name: CHROMOSOME_REGIONType: varchar(50)Example: 2:105000-106000
- Please use REFERENCE_ACCESSION and REFERENCE_OFFSET.
-
SUBSPECIES_ID - Name of subspecies.
-
Name: SUBSPECIES_IDType: varchar(50)Example: Verus
- Please use STRAIN and SPECIES_CODE. Subspecies information should be incorporated into the SPECIES_CODE field.
-
TRACE_DIRECTION -
Direction of the read.
-
Name: TRACE_DIRECTIONType: varchar(50)Example: FORWARD
- Please use TRACE_END instead.
Submission Information
The submitting data should be placed on a provided by NCBI secure FTP site (ftp://ftp-trace.ncbi.nlm.nih.gov). Contact to obtain a secure FTP account. Please have a contact information as well as a full center's name and the center's acronym provided with the request.
All submissions made to NCBI via ftp are automatically picked up by Ensembl. (http://trace.ensembl.org)
Submissions made to Ensembl are placed on NCBI FTP site to pick up and load.
Each submission is a single file in UNIX USTAR format compressed with "gzip" utility. It is suggested to have the size of the submission file between 1 and 4 GB. It also is suggested to use unique names for the submissions and include the center's name and the date into its name.
All submissions when extracted should have a top directory. The top directory may be named similar to the submission's file. All ancillary files should be placed under that directory. In case when the submission should contain trace files at least one more directory should be introduced to the top directory and all trace files should be placed under that directory.
Below is what should be placed under the top directory.
- TRACEINFO.xml or TRACEINFO.txt: either one must be present. This is the main file describing the submission. It contains ancillary data and references to trace files if necessary. It can be either in XML or tab delimited format.
- MD5: md5 hashes, suggested to be present.
- README: free text describing this volume and preparation.
Below are examples of the submission directory hierarchy and examples of TRACEINFO ancillary files.
The trace files should not appear in the top level directory, but rather should be in a subdirectory. It is suggested to use the name of the traces or the name of the project for subdirectories. There may be subdirectories within and this is encouraged to group traces.
NEW and UPDATE submissions
NEW and UPDATE submissions should have the structure shown below:
Examples are available for download: ftp://ftp-private.ncbi.nlm.nih.gov/pub/TraceDB/misc/examples
The ancillary TRACEINFO file describes the submitted data as well as points to the location of the chromatograms. XML format is preferable, since it is easier for a human to read if necessary. The ancillary data requirements are in the Validation Table (Excel format) for specific combinations of STRATEGY and TRACE_TYPE_CODE. Both types of ancillary files can contain common fields section at the beginning of it. This section defines common for the submission values if any.
TRACEINFO.xml exampleIf the trace info is provided as an XML file the info fields will serve as the tags. To preserve the grouping, the trace_volume tag is used.
<?xml version="1.0" encoding="UTF-8"?>
<trace_volume>
<common_fields>
<center_name>CENTER NAME ACRONYM IS HERE</center_name>
<submission_type>NEW</submission_type>
<strategy>WGS</strategy>
<trace_type_code>WGS</trace_type_code>
<center_project>Gorilla WGS</center_project>
<source_type>G</source_type>
<species_code>Gorilla gorilla</species_code>
<insert_size>1500</insert_size>
</common_fields>
<trace>
<template_id>HBBAA1U0001</template_id>
<trace_name>HBBAA1U0001</trace_name>
<trace_file>traces/HBBA/HBBAA1U0001.scf</trace_file>
<trace_format>scf</trace_format>
<trace_end>R</trace_end>
<clip_vector_left>56</clip_vector_left>
<clip_vector_right>737</clip_vector_right>
<run_machine_id>legrenzi</run_machine_id>
<chemistry>BIGDYEV2</chemistry>
<program_id>phred version=0.020425.c</program_id>
<run_machine_type>ABI 3700</run_machine_type>
</trace>
<trace>
<template_id>HBBAA1U0002</template_id>
<trace_name>HBBAA1U0002</trace_name>
...more info...
</trace>
</trace_volume>
Tabular file has the following format, and either has no extension at all, or its name is extended with '.txt' or '.tbl'. Data represents the actual values of the fields described in the header. It is also tab delimited
center_name = CENTER NAME ACRONYM IS HERE
submission_type = NEW
strategy = WGA
trace_type_code = WGS
center_project = Gorilla WGS
source_type = G
species_code = Gorilla gorilla
insert_size = 1500
template_id trace_name trace_file trace_format trace_end clip_vector_left clip_vector_right run_machine_id chemistry program_id run_machine_type
HBBAA1U0001 HBBAA1U0001 traces/HBBA/HBBAA1U0001.scf scf R 56 737 legrenzi BIGDYEV2 phred version=0.020425.c ABI 3700 s2SCF scf F 44 793 agricola BIGDYEV2 phred version=0.020425.c ABI 3700
HBBAA1U0002 HBBAA1U0002 ...
...
728018368a7820c50cbaad633bc608a1 TRACEINFO 0cbaad633bc608a1728018368a7820c5 traces/TRACE0001.scf
UPDATEINFO submission
An UPDATEINFO submission should have the structure shown below:
TOP_DIRECTORY/ TOP_DIRECTORY/TRACEINFO.txt TOP_DIRECTORY/MD5 TOP_DIRECTORY/README
TRACEINFO file in this case has to have SUBMISSION_TYPE=UPDATEINFO, the unique keys to the traces(CENTER_NAME and TRACE_NAME) and fields with their values that you wish to update. These data will be uploaded into our database without changing the ti's and the rest information. This file can contain common fields section at the beginning of it. This section defines common for the submission values if any.
TRACEINFO.xml exampleIf the trace info is provided as an XML file the info fields will serve as the tags. To preserve the grouping, the trace_volume tag is used.
<?xml version="1.0"?>
<trace_volume>
<common_fields>
<center_name>CENTER NAME ACRONYM IS HERE</center_name>
<submission_type>UPDATEINFO</submission_type>
<trace_type_code>WGS</trace_type_code>
<insert_size>40000</insert_size>
</common_fields>
<trace>
<trace_name>HBBA0001</trace_name>
<template_id>template_id_HBBA0001</template_id>
...more info...
</trace>
<trace>
<trace_name>HBBA0002</trace_name>
<template_id>template_id_HBBA0002</template_id>
...more info...
</trace>
</trace_volume>
Tabular file has the following format, and either has no extension at all, or its name is extended with '.txt' or '.tbl'. Data represents the actual values of the fields described in the header. It is also tab delimited
SUBMISSION_TYPE=UPDATEINFO CENTER_NAME=CENTER NAME ACRONYM IS HERE trace_name clip_vector_left clip_vector_right more fields (if necessary)... my_trace1 33 89 ... my_trace2 19 80 ... my_trace2 1 68 ... more trace_name's...
728018368a7820c50cbaad633bc608a1 TRACEINFO 0cbaad633bc608a1728018368a7820c5 traces/TRACE0001.scf
WITHDRAW submission
To delete traces use SUBMISSION_TYPE =WITHDRAW
A WITHDRAW submission is a TRACEINFO file inside a tar file, just as any regular Trace Archive submission. It should have the structure shown below:
TOP_DIRECTORY/ TOP_DIRECTORY/TRACEINFO.txt
WITHDRAW type of submission is very similar to UPDATEINFO, except you do not have to supply extra fields but center_name, trace_name and submission_type=WITHDRAW
submission_type = WITHDRAW center_name = CENTER NAME ACRONYM IS HERE trace_name my_trace1 my_trace2 my_trace2 ...
Tracking Submissions
When a submission is loaded a log file is generated. This log file contains the ti and read name for passed reads and a list of the reads that were rejected.
If more than 5% of the reads from a particular submission fail, the entire submission will be rejected.
A tracking system has been implemented that will allow the tracking of individual submissions. Each FTP submission is given a unique tracking identifier (SID). Submissions can be tracked by name, SID, date or status. The submitting center will be notified via ftp when a submission has been processed.
After each submission has been processed log files documenting the load are placed on the FTP site.
There is an ability to track the submissions with query_tracedb Perl script. The output is in XML format.
Examples:
$ query_tracedb "track name='NISC_mkp_2006-09-22.tar.gz'"
$ query_tracedb "track sid=174661"
$ query_tracedb "track name in ('NISC_mkp_2006-09-22.tar.gz', 'NISC_jyp_2006-09-22.tar.gz')"
$ query_tracedb "track sid in (174661, 174657)"
If submission does not completely comply to the RFC it will be either rejected or a warning will be sent.
Some ancillary fields are mutually exclusive or not required for a particular type of submission. Please do not include redundant fields into the submission; it can be rejected because of this. For example, if no chromosome information is available for a read, the CHROMOSOME field should not be included.
If a read fails the reason of it failure will be documented in the log file. For example it can fail for the following reasons:
- Information in the ancillary information file, but no trace file
- Zero length trace file
- Number of bases does not match the number of quality values
- There is a trace file but no ancillary information
- If the SUBMISSION_TYPE field has the value 'NEW' but the values in the CENTER_NAME and TRACE_NAME fields are already in the database, the read will be rejected.
- If the same read name is found more than one time in the tar file all reads with that name are failed.

